(Solved): [Questions 17-20] After removal of this H3K27ac region in normal cells, the researchers decide to ...

[Questions 17-20] After removal of this H3K27ac region in normal cells, the researchers decide to reintroduce the original sequence back into human cancer cells that had the deletion. The aim is to precisely insert the H3K27ac region to the genome of cancer cells. The human reference genome sequence above has been provided below in text format for accessibility: 5:- TGGAGGACTGTGITTGITGAAAAGAACAGAAGTCTICAGTCATTTAGAATAAAGCTGC 3' 17. To perform this experiment, one single-guide RNA (sgRNA) and a homologous recombination template must be used. True False Question 18 18. In tumor cells that have the H3K27ac DNA region reintroduced, which of the following results would provide genetic evidence of functionality if the H3K27ac region was a repressor? 18. In tumor cells that have the H3K27ac DNA region reintroduced, which of the following results would provide genetic evidence of functionality if the \( \mathrm{H} 3 \mathrm{~K} 27 \mathrm{ac} \) region was a repressor? 19. There are more potential Cas9 PAM sequences within the forward strand than on the reverse strand of this region of the human genome. True False Question 20 20. The sgRNA sequence 5'TCAGTCATTTAGAATAAAGC-3' will hybridize within the H3K27ac region after Cas9 unwinds the DNA. True False